EasyManua.ls Logo

Fluidigm Access Array - Prepare Primer Validation Reactions

Fluidigm Access Array
51 pages
Print Icon
To Next Page IconTo Next Page
To Next Page IconTo Next Page
To Previous Page IconTo Previous Page
To Previous Page IconTo Previous Page
Loading...
Access Array System for the Ion Torrent PGM Sequencing System: User Guide
Chapter 3: Target-Specific Primer Validation for 4-Primer Amplicon Tagging on the LP 48.48 IFC
Prepare Primer Validation Reactions
18
Reagents from Other Suppliers
Prepare Primer Validation Reactions
The primer validation protocol prepares enough reagents to perform 48 primer validation
reactions.
IMPORTANT It is essential to have Access Array Barcode 1 primers before proceeding with
the primer validation. See Table 1 below for the oligo sequences.
Table 1. Access Array Barcode 1 primers for Ion Torrent
1 Prepare the 5X target-specific primer solution for 48 individual primer pairs as shown in
the table below.
Table 2. 5X target-specific primer solution preparation
2 Vortex the 5X target-specific primer solution for a minimum of 20 seconds and
centrifuge for 30 seconds.
NOTE The final tagged TS forward and reverse primer concentrations are 250 nM in the
5X primer solution. The final TS forward and reverse primer concentrations in the PCR
reaction are 50 nM.
3 Prepare 2 M Access Array Barcode 1 primer solution.
Product Name Manufacturer Part Number
FastStart™ High Fidelity PCR System, dNTPack Sigma-Aldrich 04738292001
Agilent DNA 1000 Kit Agilent 5067-1504
PCR Certified Water Teknova W3330
60 ng/L genomic DNA (optional) Coriell NA17317
Name Sequence (5-3) Total Length
A_BC1_CS1 forward primer CCATCTCATCCCTGCGTGTCTCCGACTCAGACGAGTG
CGTACACTGACGACATGGTTCTACA
62 bp
P1_CS2 reverse primer CCTCTCTATGGGCAGTCGGTGATTACGGTA
GCAGAGACTTGGTCT
45 bp
Component Volume
(μL)
Final
Concentration* (nM)
* The final concentration in this table refers to the amount of each listed component in 5 L of
the final primer solution.
50 M CS1-tagged TS forward primer 1 250
50 M CS2-tagged TS reverse primer 1 250
PCR Certified Water (Teknova) 198
Total 200

Table of Contents